Sequence retrieval

Genome: Serratia symbiotica str. 'Cinara cedri'
Start position: 78223
End position: 78249
Length: 27

DNA sequence
>NC_016632, from 78223 to 78249 (27 bp); Serratia symbiotica str. 'Cinara cedri' GCACGACCAGCACGACCAGCACGACCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 77392-79275	Sequence	SCc_049 deaD ATP-dependent RNA helicase (Protein is coded in complementary strand; from 79275 to 77392)