Sequence retrieval

Genome: Serratia symbiotica str. 'Cinara cedri'
Start position: 157496
End position: 157531
Length: 36

DNA sequence
>NC_016632, from 157496 to 157531 (36 bp); Serratia symbiotica str. 'Cinara cedri' CATGCCACCCATGCCACCCATGCCACCCATGCCACC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 157491-159137	Sequence	SCc_097 groEL chaperone Hsp60 (Protein is coded in complementary strand; from 159137 to 157491)