Sequence retrieval

Genome: Dechlorosoma suillum PS
Start position: 52116
End position: 52160
Length: 45

DNA sequence
>NC_016616, from 52116 to 52160 (45 bp); Dechlorosoma suillum PS GCACCAGCAGGGACACCAGCAGCAGGGGCAGCAACAGCACGGCCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 51641-52201	Sequence	Dsui_0054 - glycosyl transferase family protein (Protein is coded in complementary strand; from 52201 to 51641)