Sequence retrieval

Genome: Dechlorosoma suillum PS
Start position: 485664
End position: 485708
Length: 45

DNA sequence
>NC_016616, from 485664 to 485708 (45 bp); Dechlorosoma suillum PS TTTCGGCTCTTCCTTTTTCGGCTCCGGCTTTTTCTTCTCTTCCTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 485191-485991	Sequence	Dsui_0480 - periplasmic protein TonB, links inner and outer membranes (Protein is coded in complementary strand; from 485991 to 485191)