Sequence retrieval

Genome: Dechlorosoma suillum PS
Start position: 3695400
End position: 3695444
Length: 45

DNA sequence
>NC_016616, from 3695400 to 3695444 (45 bp); Dechlorosoma suillum PS CGGCGGCGGCCTGCTCGGCGGCGCCGTTCTCGGCGGCCGCCGACT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3694316-3695965	Sequence	Dsui_3439 - methyl-accepting chemotaxis protein (Protein is coded in complementary strand; from 3695965 to 3694316)