Sequence retrieval

Genome: Dechlorosoma suillum PS
Start position: 122885
End position: 122929
Length: 45

DNA sequence
>NC_016616, from 122885 to 122929 (45 bp); Dechlorosoma suillum PS GGCGCCGGCGGCCAGGGCCGAGGCGGCCAGGGCGGCGGGGGCCAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 122607-123344	Sequence	Dsui_0125 - NAD-dependent aldehyde dehydrogenase (Protein is coded in complementary strand; from 123344 to 122607)