Sequence retrieval

Genome: Dechlorosoma suillum PS
Start position: 456257
End position: 456292
Length: 36

DNA sequence
>NC_016616, from 456257 to 456292 (36 bp); Dechlorosoma suillum PS CGGCGATGAAGGCGGAGACGAAGGCGGCGACGAAGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 456133-456957	Sequence	Dsui_0449 - undecaprenyl-diphosphatase UppP (Protein is coded in complementary strand; from 456957 to 456133)