Sequence retrieval

Genome: Dechlorosoma suillum PS
Start position: 3430445
End position: 3430480
Length: 36

DNA sequence
>NC_016616, from 3430445 to 3430480 (36 bp); Dechlorosoma suillum PS GCCGCCGGGGCTGCCTCAGGGGCTGCCTCAGGGGCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3429809-3432817	Sequence	Dsui_3196 - FimV N-terminal domain-containing protein (Protein is coded in complementary strand; from 3432817 to 3429809)