Sequence retrieval

Genome: Dechlorosoma suillum PS
Start position: 2147457
End position: 2147492
Length: 36

DNA sequence
>NC_016616, from 2147457 to 2147492 (36 bp); Dechlorosoma suillum PS GGCAACGCATCAGGCAAGGAATCAGGCAAAGAATCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF.. 2147166-2147462	Sequence	Dsui_2028 - putative endonuclease containing a URI domain (Protein is coded in complementary strand; from 2147462 to 2147166)