Sequence retrieval

Genome: Dechlorosoma suillum PS
Start position: 1325906
End position: 1325941
Length: 36

DNA sequence
>NC_016616, from 1325906 to 1325941 (36 bp); Dechlorosoma suillum PS GAAGAAGTCCAGGAAGAAGGCCAGGACGAAGACCAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1325493-1326959	Sequence	Dsui_1262 - TRAP C4-dicarboxylate transport system permease DctM (Protein is coded in complementary strand; from 1326959 to 1325493)