Sequence retrieval

Genome: Dechlorosoma suillum PS
Start position: 460689
End position: 460718
Length: 30

DNA sequence
>NC_016616, from 460689 to 460718 (30 bp); Dechlorosoma suillum PS CGGCACCGGCCGGCACCACCCGGCAGCTGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 460028-460786	Sequence	Dsui_0455 - putative integral membrane protein (Protein is coded in complementary strand; from 460786 to 460028)