Sequence retrieval

Genome: Dechlorosoma suillum PS
Start position: 2380107
End position: 2380136
Length: 30

DNA sequence
>NC_016616, from 2380107 to 2380136 (30 bp); Dechlorosoma suillum PS AGTGGGAGTGGGAGTGGGAGTGGGAGTGGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2379178-2380164	Sequence	Dsui_2236 - dipeptide/oligopeptide/nickel ABC transporter permease (Protein is coded in complementary strand; from 2380164 to 2379178)