Sequence retrieval

Genome: Dechlorosoma suillum PS
Start position: 3240125
End position: 3240151
Length: 27

DNA sequence
>NC_016616, from 3240125 to 3240151 (27 bp); Dechlorosoma suillum PS TTCCACCAGTTCCACCAGTTCCAGCAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3239688-3240245	Sequence	Dsui_3028 - coenzyme F420-reducing hydrogenase subunit gamma (Protein is coded in complementary strand; from 3240245 to 3239688)