Sequence retrieval

Genome: Dechlorosoma suillum PS
Start position: 2596543
End position: 2596569
Length: 27

DNA sequence
>NC_016616, from 2596543 to 2596569 (27 bp); Dechlorosoma suillum PS GCGACGACCGCGACGACCGCGACCACC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2595977-2598739	Sequence	Dsui_2436 - ribonuclease, Rne/Rng family (Protein is coded in complementary strand; from 2598739 to 2595977)