Sequence retrieval

Genome: Dechlorosoma suillum PS
Start position: 1663915
End position: 1663939
Length: 25

DNA sequence
>NC_016616, from 1663915 to 1663939 (25 bp); Dechlorosoma suillum PS GGCCGGGGCGGGGCGGTCCGGGGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1663088-1664110	Sequence	Dsui_1585 - 4-hydroxythreonine-4-phosphate dehydrogenase (Protein is coded in complementary strand; from 1664110 to 1663088)