Sequence retrieval

Genome: Dechlorosoma suillum PS
Start position: 911804
End position: 911827
Length: 24

DNA sequence
>NC_016616, from 911804 to 911827 (24 bp); Dechlorosoma suillum PS GATGGTGATGGGGATGATGATGGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 911340-914450	Sequence	Dsui_0896 - heavy metal efflux pump (Protein is coded in complementary strand; from 914450 to 911340)