Sequence retrieval

Genome: Dechlorosoma suillum PS
Start position: 876126
End position: 876149
Length: 24

DNA sequence
>NC_016616, from 876126 to 876149 (24 bp); Dechlorosoma suillum PS GACCAGGGCCAGGCCCAGAACCAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 875269-876180	Sequence	Dsui_0860 - hypothetical protein (Protein is coded in complementary strand; from 876180 to 875269)