Sequence retrieval

Genome: Dechlorosoma suillum PS
Start position: 821939
End position: 821962
Length: 24

DNA sequence
>NC_016616, from 821939 to 821962 (24 bp); Dechlorosoma suillum PS ACAGGGCCAGGGTCAGGGTCAGGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 820666-822786	Sequence	Dsui_0810 - signal transduction histidine kinase involved in nitrogen fixation and metabolism regulation (Protein is coded in complementary strand; from 822786 to 820666)