Sequence retrieval

Genome: Dechlorosoma suillum PS
Start position: 812730
End position: 812753
Length: 24

DNA sequence
>NC_016616, from 812730 to 812753 (24 bp); Dechlorosoma suillum PS CCAGGGCCCGGGCCTGGGCCAGGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 812513-814537	Sequence	Dsui_0805 - primosomal protein N'' (Protein is coded in complementary strand; from 814537 to 812513)