Sequence retrieval

Genome: Dechlorosoma suillum PS
Start position: 651569
End position: 651592
Length: 24

DNA sequence
>NC_016616, from 651569 to 651592 (24 bp); Dechlorosoma suillum PS CGTTGCCGTCGCCGTTGTCGTTGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 649135-655254	Sequence	Dsui_0656 - chemotaxis protein histidine kinase-like protein (Protein is coded in complementary strand; from 655254 to 649135)