Sequence retrieval

Genome: Dechlorosoma suillum PS
Start position: 623535
End position: 623558
Length: 24

DNA sequence
>NC_016616, from 623535 to 623558 (24 bp); Dechlorosoma suillum PS GGAGCGGAAGCGGAAGCGGGAGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 623508-624812	Sequence	Dsui_0630 - branched-chain amino acid ABC transporter periplasmic protein (Protein is coded in complementary strand; from 624812 to 623508)