Sequence retrieval

Genome: Dechlorosoma suillum PS
Start position: 590038
End position: 590061
Length: 24

DNA sequence
>NC_016616, from 590038 to 590061 (24 bp); Dechlorosoma suillum PS GCCCAGGCCCTGGCCCTGGGCCAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 589652-591292	Sequence	Dsui_0592 - putative polymerase with PALM domain, HD hydrolase domain and Zn ribbon