Sequence retrieval

Genome: Dechlorosoma suillum PS
Start position: 569966
End position: 569989
Length: 24

DNA sequence
>NC_016616, from 569966 to 569989 (24 bp); Dechlorosoma suillum PS GGGCAGGGGCGGCGGCAGGTGCAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 569562-570041	Sequence	Dsui_0569 - hypothetical protein (Protein is coded in complementary strand; from 570041 to 569562)