Sequence retrieval

Genome: Dechlorosoma suillum PS
Start position: 452445
End position: 452468
Length: 24

DNA sequence
>NC_016616, from 452445 to 452468 (24 bp); Dechlorosoma suillum PS GGCCTGGGCCAGGGCCTGGGCGTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 451786-452673	Sequence	Dsui_0445 - TonB family protein (Protein is coded in complementary strand; from 452673 to 451786)