Sequence retrieval

Genome: Dechlorosoma suillum PS
Start position: 442400
End position: 442423
Length: 24

DNA sequence
>NC_016616, from 442400 to 442423 (24 bp); Dechlorosoma suillum PS GGTGGTGGTAGTGGTGCTGGCGGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 442204-442791	Sequence	Dsui_0435 - Sel1 repeat protein (Protein is coded in complementary strand; from 442791 to 442204)