Sequence retrieval

Genome: Dechlorosoma suillum PS
Start position: 435160
End position: 435183
Length: 24

DNA sequence
>NC_016616, from 435160 to 435183 (24 bp); Dechlorosoma suillum PS GGCGGCGGCGGAAGCGGCGGCGGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 434813-435961	Sequence	Dsui_0429 - cystathionine beta-lyase/cystathionine gamma-synthase (Protein is coded in complementary strand; from 435961 to 434813)