Sequence retrieval

Genome: Dechlorosoma suillum PS
Start position: 3586636
End position: 3586659
Length: 24

DNA sequence
>NC_016616, from 3586636 to 3586659 (24 bp); Dechlorosoma suillum PS CCTGGCCCAGGCCCAGGCGCTGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3585435-3586697	Sequence	Dsui_3346 - putative signal transduction protein containing EAL and modified HD-GYP domains