Sequence retrieval

Genome: Dechlorosoma suillum PS
Start position: 3461040
End position: 3461063
Length: 24

DNA sequence
>NC_016616, from 3461040 to 3461063 (24 bp); Dechlorosoma suillum PS CCTCGGCCTCGACCTTGGCCTCGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3460760-3461305	Sequence	Dsui_3222 - oligoribonuclease (Protein is coded in complementary strand; from 3461305 to 3460760)