Sequence retrieval

Genome: Dechlorosoma suillum PS
Start position: 3403657
End position: 3403680
Length: 24

DNA sequence
>NC_016616, from 3403657 to 3403680 (24 bp); Dechlorosoma suillum PS CTGGCCCTGCCCCTGGCGCTGGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3403481-3404902	Sequence	Dsui_3174 - DNA/RNA helicase (Protein is coded in complementary strand; from 3404902 to 3403481)