Sequence retrieval

Genome: Dechlorosoma suillum PS
Start position: 3318549
End position: 3318572
Length: 24

DNA sequence
>NC_016616, from 3318549 to 3318572 (24 bp); Dechlorosoma suillum PS CAGGGCCAGGGGCAGCGCCAGGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3318196-3319125	Sequence	Dsui_3100 - putative permease (Protein is coded in complementary strand; from 3319125 to 3318196)