Sequence retrieval

Genome: Dechlorosoma suillum PS
Start position: 3088857
End position: 3088880
Length: 24

DNA sequence
>NC_016616, from 3088857 to 3088880 (24 bp); Dechlorosoma suillum PS GGGCCTTGGCCTGGTCCTGGGCGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3088619-3092596	Sequence	Dsui_2892 - phosphoribosylformylglycinamidine synthase, single chain form (Protein is coded in complementary strand; from 3092596 to 3088619)