Sequence retrieval

Genome: Dechlorosoma suillum PS
Start position: 2985093
End position: 2985116
Length: 24

DNA sequence
>NC_016616, from 2985093 to 2985116 (24 bp); Dechlorosoma suillum PS CCAGGGCCAGGGCCCGGGCCAGGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2984798-2985571	Sequence	Dsui_2811 - ABC-type transport system involved in resistance to organic solvents, ATPase component (Protein is coded in complementary strand; from 2985571 to 2984798)