Sequence retrieval

Genome: Dechlorosoma suillum PS
Start position: 2984525
End position: 2984548
Length: 24

DNA sequence
>NC_016616, from 2984525 to 2984548 (24 bp); Dechlorosoma suillum PS GGATGCTGATGCGGATGAGGATGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2983855-2984778	Sequence	Dsui_2810 - organic solvent resistance ABC transporter periplasmic protein (Protein is coded in complementary strand; from 2984778 to 2983855)