Sequence retrieval

Genome: Dechlorosoma suillum PS
Start position: 2969461
End position: 2969484
Length: 24

DNA sequence
>NC_016616, from 2969461 to 2969484 (24 bp); Dechlorosoma suillum PS GGCGGCGTCGGCGGCAGCGGCAGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2968490-2970502	Sequence	Dsui_2799 - oligopeptide/dipeptide ABC transporter ATP-binding protein (Protein is coded in complementary strand; from 2970502 to 2968490)