Sequence retrieval

Genome: Dechlorosoma suillum PS
Start position: 2955473
End position: 2955496
Length: 24

DNA sequence
>NC_016616, from 2955473 to 2955496 (24 bp); Dechlorosoma suillum PS TCGGCCACGGCCTCGGCCTGGGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2953040-2955583	Sequence	Dsui_2785 - DNA topoisomerase IV, A subunit, proteobacterial (Protein is coded in complementary strand; from 2955583 to 2953040)