Sequence retrieval

Genome: Dechlorosoma suillum PS
Start position: 2416411
End position: 2416434
Length: 24

DNA sequence
>NC_016616, from 2416411 to 2416434 (24 bp); Dechlorosoma suillum PS CAGGCGCAGGCGCGGGCGCAGGTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2413814-2417146	Sequence	Dsui_2265 - DNA-directed DNA polymerase III PolC (Protein is coded in complementary strand; from 2417146 to 2413814)