Sequence retrieval

Genome: Dechlorosoma suillum PS
Start position: 2391828
End position: 2391851
Length: 24

DNA sequence
>NC_016616, from 2391828 to 2391851 (24 bp); Dechlorosoma suillum PS CCCGGGCCAGGGCCCGGTCCTGGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2390804-2393407	Sequence	Dsui_2244 - DNA mismatch repair protein MutS (Protein is coded in complementary strand; from 2393407 to 2390804)