Sequence retrieval

Genome: Dechlorosoma suillum PS
Start position: 2171827
End position: 2171850
Length: 24

DNA sequence
>NC_016616, from 2171827 to 2171850 (24 bp); Dechlorosoma suillum PS AGCAGCAGCACCAGCAGCACCAGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2170240-2171943	Sequence	Dsui_2049 - ABC transporter permease/ATPase (Protein is coded in complementary strand; from 2171943 to 2170240)