Sequence retrieval

Genome: Dechlorosoma suillum PS
Start position: 2095345
End position: 2095368
Length: 24

DNA sequence
>NC_016616, from 2095345 to 2095368 (24 bp); Dechlorosoma suillum PS GATGGCGTTGGCGATGGGGATGGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2094974-2096650	Sequence	Dsui_1986 - sulfite reductase [NADPH] hemoprotein subunit beta (Protein is coded in complementary strand; from 2096650 to 2094974)