Sequence retrieval

Genome: Dechlorosoma suillum PS
Start position: 1971901
End position: 1971924
Length: 24

DNA sequence
>NC_016616, from 1971901 to 1971924 (24 bp); Dechlorosoma suillum PS CTCGGCCTTGGCCTTGGCTTCGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1971002-1972261	Sequence	Dsui_1872 - RND family efflux transporter, MFP subunit (Protein is coded in complementary strand; from 1972261 to 1971002)