Sequence retrieval

Genome: Dechlorosoma suillum PS
Start position: 1970906
End position: 1970929
Length: 24

DNA sequence
>NC_016616, from 1970906 to 1970929 (24 bp); Dechlorosoma suillum PS GGCGATGACGATGACGATGGAGAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1967838-1970972	Sequence	Dsui_1871 - hydrophobe/amphiphile efflux-1 (HAE1) family transporter (Protein is coded in complementary strand; from 1970972 to 1967838)