Sequence retrieval

Genome: Dechlorosoma suillum PS
Start position: 1759408
End position: 1759431
Length: 24

DNA sequence
>NC_016616, from 1759408 to 1759431 (24 bp); Dechlorosoma suillum PS CAGGGCCACGGCCAGGGCCAGGGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1756637-1759483	Sequence	Dsui_1671 - outer membrane receptor for ferrienterochelin and colicins (Protein is coded in complementary strand; from 1759483 to 1756637)