Sequence retrieval

Genome: Dechlorosoma suillum PS
Start position: 1456435
End position: 1456458
Length: 24

DNA sequence
>NC_016616, from 1456435 to 1456458 (24 bp); Dechlorosoma suillum PS CGAGGGTGAGGGCGAGGCCCAGGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1455873-1457318	Sequence	Dsui_1396 - type II secretory pathway protein ExeA (Protein is coded in complementary strand; from 1457318 to 1455873)