Sequence retrieval

Genome: Dechlorosoma suillum PS
Start position: 1455148
End position: 1455171
Length: 24

DNA sequence
>NC_016616, from 1455148 to 1455171 (24 bp); Dechlorosoma suillum PS GCTGGCGCCGGCGCCGGCGGTGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1453814-1455718	Sequence	Dsui_1395 - MSHA-type pilus biogenesis protein MshL (Protein is coded in complementary strand; from 1455718 to 1453814)