Sequence retrieval

Genome: Dechlorosoma suillum PS
Start position: 1335038
End position: 1335061
Length: 24

DNA sequence
>NC_016616, from 1335038 to 1335061 (24 bp); Dechlorosoma suillum PS GCTGCTGGTGCTGCTCCTTCTGCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1334365-1335825	Sequence	Dsui_1271 - membrane-bound metallopeptidase (Protein is coded in complementary strand; from 1335825 to 1334365)