Sequence retrieval

Genome: Dechlorosoma suillum PS
Start position: 1024384
End position: 1024407
Length: 24

DNA sequence
>NC_016616, from 1024384 to 1024407 (24 bp); Dechlorosoma suillum PS ACCAGGGCCAGGACCAGCACCTGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1023346-1025373	Sequence	Dsui_0997 - methyl-accepting chemotaxis protein (Protein is coded in complementary strand; from 1025373 to 1023346)