Sequence retrieval

Genome: Dechlorosoma suillum PS
Start position: 1012307
End position: 1012330
Length: 24

DNA sequence
>NC_016616, from 1012307 to 1012330 (24 bp); Dechlorosoma suillum PS TGGCGGTGCCGGTGCCGGTGGCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1010975-1013275	Sequence	Dsui_0983 - PAS domain S-box/diguanylate cyclase (GGDEF) domain-containing protein