Sequence retrieval

Genome: Vibrio sp. EJY3
Start position: 81363
End position: 81392
Length: 30

DNA sequence
>NC_016613, from 81363 to 81392 (30 bp); Vibrio sp. EJY3 GCTCTTTATTGCGCTTTTTTGCTCATCATT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 78556-82080	Sequence	VEJY3_00325 - hypothetical protein (Protein is coded in complementary strand; from 82080 to 78556)