Sequence retrieval

Genome: Vibrio sp. EJY3
Start position: 3243513
End position: 3243548
Length: 36

DNA sequence
>NC_016613, from 3243513 to 3243548 (36 bp); Vibrio sp. EJY3 CCGCCCATACCACCCATACCGCCCATGCCGCCCATA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3243504-3245150	Sequence	VEJY3_14505 groEL chaperonin GroEL (Protein is coded in complementary strand; from 3245150 to 3243504)