Sequence retrieval

Genome: Vibrio sp. EJY3
Start position: 2985435
End position: 2985458
Length: 24

DNA sequence
>NC_016613, from 2985435 to 2985458 (24 bp); Vibrio sp. EJY3 AGAGCAAGACCAACAGCAAGACCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2984919-2985785	Sequence	VEJY3_13375 - hypothetical protein (Protein is coded in complementary strand; from 2985785 to 2984919)